View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-14 (Length: 195)
Name: Solexa-NF5704-14
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 2 - 191
Target Start/End: Complemental strand, 47447888 - 47447699
Alignment:
| Q |
2 |
agcagagaagaaattttgtacaattatgaaggtagaaggagaaatttggtgaaagacaaatgcaaatggatgaatctgttgcatttataaaggtatagga |
101 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47447888 |
agcagaaaagaaattttgtacaattatgaaggtagaaggagaaatttggtgaaagacaaatgcaaatggatgaatctgttgcatttataaaggtataggt |
47447789 |
T |
|
| Q |
102 |
gagaattgttaattccattactaatgtgtattgtgtactatatatttgattggtacttacattggaacaatgtttgttgtggcagggact |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47447788 |
gagaattgttaattccattactaatgtgtattgtgtactatatatttgattggtacttacattggaacaatgtttgttgtggcagggact |
47447699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University