View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-16 (Length: 122)
Name: Solexa-NF5704-16
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 3 - 120
Target Start/End: Original strand, 4403907 - 4404025
Alignment:
| Q |
3 |
cagaccatgttttaatgttggact-aatcattccagtccatgggtcatgcttattttgatagttctgttctattatttatacctggaaaaatctgtttcc |
101 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4403907 |
cagaccatgttttaatgttggacttaatcattccagcccatgggtcatgcttattttgatagttctgttctattatttatacctggaaaaatctgtttcc |
4404006 |
T |
|
| Q |
102 |
ctctgaattgtcaattaag |
120 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
4404007 |
ctctaaattgtcaattaag |
4404025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University