View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-17 (Length: 153)
Name: Solexa-NF5704-17
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 8 - 153
Target Start/End: Original strand, 36459819 - 36459964
Alignment:
| Q |
8 |
attcttcctatttctttctttcaaatttcaattgcttgttagacaattcttgattcaaaagcaatctaaattttcaacttttttattctaaatttcattc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36459819 |
attcttcctatttctttctttcaaatttcaattgcttgttagacaattcttgattcaaaagcaatctaaattttcaacttttttattctaaatttcattc |
36459918 |
T |
 |
| Q |
108 |
atttaccactctctgaattttgggtttactcatatgctttcaatct |
153 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36459919 |
atttaccactctctgaattttcggtttactcatatgctttcaatct |
36459964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University