View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-2 (Length: 122)
Name: Solexa-NF5704-2
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 3e-52; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 36425697 - 36425590
Alignment:
| Q |
8 |
atatgagagtgctacatagttgtcatcttcaacgaaagaaacgttacgaacggccatatctcgtttcatattaggtagacctactaatatttctccgttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36425697 |
atatgagagtgctacatagttgtcatcttcaacgaaagaaacgttacgaacggccatatctcgtttcatattaggtagacctactaatatttctccgttc |
36425598 |
T |
|
| Q |
108 |
caacgtcc |
115 |
Q |
| |
|
||| |||| |
|
|
| T |
36425597 |
caatgtcc |
36425590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 36411531 - 36411424
Alignment:
| Q |
8 |
atatgagagtgctacatagttgtcatcttcaacgaaagaaacgttacgaacggccatatctcgtttcatattaggtagacctactaatatttctccgttc |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |||||||| |||||||||| | |||||| |||||| |||||||||||| |||| ||| |
|
|
| T |
36411531 |
atatgagagtgatacatagttgtcatcttcaacccaagaaacattacgaactgccatatctcctatcatatgaggtaggcctactaatattgctccattc |
36411432 |
T |
|
| Q |
108 |
caacgtcc |
115 |
Q |
| |
|
||| |||| |
|
|
| T |
36411431 |
caatgtcc |
36411424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 36416862 - 36416755
Alignment:
| Q |
8 |
atatgagagtgctacatagttgtcatcttcaacgaaagaaacgttacgaacggccatatctcgtttcatattaggtagacctactaatatttctccgttc |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |||||||| |||||||||| | |||||| |||||| |||||||||||| |||| ||| |
|
|
| T |
36416862 |
atatgagagtgatacatagttgtcatcttcaacccaagaaacattacgaactgccatatctcctatcatatgaggtaggcctactaatattgctccattc |
36416763 |
T |
|
| Q |
108 |
caacgtcc |
115 |
Q |
| |
|
||| |||| |
|
|
| T |
36416762 |
caatgtcc |
36416755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 15 - 109
Target Start/End: Complemental strand, 36368919 - 36368825
Alignment:
| Q |
15 |
agtgctacatagttgtcatcttcaacgaaagaaacgttacgaacggccatatctcgtttcatattaggtagacctactaatatttctccgttcca |
109 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||| | || ||||||||||||||||||||||| |||||| |||| |||||||||||| |
|
|
| T |
36368919 |
agtgctacatagttgtcatcttcaaccaaagaaacattaaaagtggtcatatctcgtttcatattaggtatacctacaaataattctccgttcca |
36368825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 36373545 - 36373435
Alignment:
| Q |
8 |
atatgagagtgctacatagttgtcatc---ttcaacgaaagaaacgttacgaacggccatatctcgtttcatattaggtagacctactaatatttctccg |
104 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||| || |||||||| || || |||||||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
36373545 |
atatgagattgctacatagttatcatcatcttccacaaaagaaacattcaaaatcgccatatctcgtttcatattaggtgcacctactaagattgctccg |
36373446 |
T |
|
| Q |
105 |
ttccaacgtcc |
115 |
Q |
| |
|
|||||| |||| |
|
|
| T |
36373445 |
ttccaatgtcc |
36373435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 65 - 115
Target Start/End: Complemental strand, 36397227 - 36397177
Alignment:
| Q |
65 |
atctcgtttcatattaggtagacctactaatatttctccgttccaacgtcc |
115 |
Q |
| |
|
|||||||||||||||||||| |||||| |||| | ||||||||||| |||| |
|
|
| T |
36397227 |
atctcgtttcatattaggtatacctacaaatagtgctccgttccaatgtcc |
36397177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University