View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-23 (Length: 137)
Name: Solexa-NF5704-23
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-23 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 8 - 137
Target Start/End: Complemental strand, 41249953 - 41249824
Alignment:
| Q |
8 |
gattgatgtcccacaaaaattatgagtacattttcaaattttgatgagtttaaagatgaatcgatacaggggtgatttgtaatgtagtgatcctatgatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
41249953 |
gattgatgtcccacaaaaattatgagtatattttcaaattttgatgagtttaaagatgaatcgatacaggggggatttgtaatgtagtgatcctctgatg |
41249854 |
T |
|
| Q |
108 |
ttttgcatagcatgaaatatacattattca |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41249853 |
ttttgcatagcatgaaatatacattattca |
41249824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University