View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-28 (Length: 123)
Name: Solexa-NF5704-28
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-28 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 7 - 123
Target Start/End: Original strand, 15849334 - 15849447
Alignment:
| Q |
7 |
atagtttataacaagtttaagttggaagaagtatcatccataaggacctatatgattgatacattaaattaattatttaagtcactaaagcggtgattat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15849334 |
atagtttataacaagtttaagttggaagaaatatcatccataaggacctatatgattgatacattaaatta---atttaagtcactaaagcggtgattat |
15849430 |
T |
 |
| Q |
107 |
attttcttctacctatg |
123 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15849431 |
attttcttctacctatg |
15849447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University