View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5704-29 (Length: 120)

Name: Solexa-NF5704-29
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5704-29
Solexa-NF5704-29
[»] chr4 (1 HSPs)
chr4 (7-120)||(28156633-28156746)


Alignment Details
Target: chr4 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 7 - 120
Target Start/End: Original strand, 28156633 - 28156746
Alignment:
7 agataatttgttcaccggtccggttcctggttttaatcaaactggtttgaagtacttgaatgtgtcgaataataaactctccggcgagattccggtgacg 106  Q
    ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
28156633 agataatttgttcaccggttcggttcctcgttttaatcaaactggtttgaagtacttgaatgtgtcgaataataaactctccggcgagattccggtcacg 28156732  T
107 gcggcgttgaaccg 120  Q
    ||||||||||||||    
28156733 gcggcgttgaaccg 28156746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University