View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-29 (Length: 120)
Name: Solexa-NF5704-29
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-29 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 7 - 120
Target Start/End: Original strand, 28156633 - 28156746
Alignment:
| Q |
7 |
agataatttgttcaccggtccggttcctggttttaatcaaactggtttgaagtacttgaatgtgtcgaataataaactctccggcgagattccggtgacg |
106 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28156633 |
agataatttgttcaccggttcggttcctcgttttaatcaaactggtttgaagtacttgaatgtgtcgaataataaactctccggcgagattccggtcacg |
28156732 |
T |
|
| Q |
107 |
gcggcgttgaaccg |
120 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28156733 |
gcggcgttgaaccg |
28156746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University