View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-4 (Length: 135)
Name: Solexa-NF5704-4
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 1e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 3433473 - 3433349
Alignment:
| Q |
8 |
cttttttccttttcatagatggtatctttatttctatgaaagaatcttgggtagcttgatcaatgatccaacctttgcttctccactttggaactatgac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3433473 |
cttttttccttttcatagatggtatctttatttctatgaaagaatcttgggtagcttgatcaatgatccaacctttgctttaccattttggaactatgac |
3433374 |
T |
|
| Q |
108 |
gctcctaatggcatgcaatttccct |
132 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3433373 |
gctcctaatggcatgcaatttccct |
3433349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 3427282 - 3427158
Alignment:
| Q |
8 |
cttttttccttttcatagatggtatctttatttctatgaaagaatcttgggtagcttgatcaatgatccaacctttgcttctccactttggaactatgac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3427282 |
cttttttccttttcatagatggtatctttatttctatgaaagaatcttgggtagcttgatcaatgatccaacctttgctttaccattttggaactatgac |
3427183 |
T |
|
| Q |
108 |
gctcctaatggcatgcaatttccct |
132 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
3427182 |
gctccaaatggcatgcaatttccct |
3427158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 93; Significance: 1e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 8 - 132
Target Start/End: Original strand, 11896994 - 11897118
Alignment:
| Q |
8 |
cttttttccttttcatagatggtatctttatttctatgaaagaatcttgggtagcttgatcaatgatccaacctttgcttctccactttggaactatgac |
107 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
11896994 |
cttttttccttttcataggtggtacctttatttctatgaaaggatcttaggtagcttgatcaatgatccaacctttgctttaccattttggaactatgac |
11897093 |
T |
|
| Q |
108 |
gctcctaatggcatgcaatttccct |
132 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
11897094 |
gctcctaatggcatgcgatttccct |
11897118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 3e-43
Query Start/End: Original strand, 8 - 132
Target Start/End: Original strand, 11912327 - 11912451
Alignment:
| Q |
8 |
cttttttccttttcatagatggtatctttatttctatgaaagaatcttgggtagcttgatcaatgatccaacctttgcttctccactttggaactatgac |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||||||||| ||||||||||||||| ||||||||| ||| ||||||||| |||| |
|
|
| T |
11912327 |
cttttttccttttcatagatggtacctttatttccatgagagaatcttgggtagtttgatcaatgatccagcctttgctttaccattttggaactttgac |
11912426 |
T |
|
| Q |
108 |
gctcctaatggcatgcaatttccct |
132 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
11912427 |
gctcctaatggcatgcaatttccct |
11912451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University