View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-43 (Length: 109)
Name: Solexa-NF5704-43
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-43 |
 | |
|
| [»] scaffold0038 (1 HSPs) |
| | |
|
| [»] scaffold0019 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 3e-39; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 28329246 - 28329145
Alignment:
| Q |
1 |
gacgtaggaagaaatgaaaatcacacatgaccgtttatacaccaacgggtggtcttgtgattggccggaactattatgaatgttgaattcaatatcctcc |
100 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
28329246 |
gacgttggaagaaatgaaaatcgcacatgaccatttatacaccaacgggtggtcttgtgattggccggaactattgtgaatggtgaattcaatatcctcc |
28329147 |
T |
|
| Q |
101 |
at |
102 |
Q |
| |
|
|| |
|
|
| T |
28329146 |
at |
28329145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 28506882 - 28506781
Alignment:
| Q |
1 |
gacgtaggaagaaatgaaaatcacacatgaccgtttatacaccaacgggtggtcttgtgattggccggaactattatgaatgttgaattcaatatcctcc |
100 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
28506882 |
gacgttggaagaaatgaaaatcgcacatgaccatttatacaccaacgggtggtcttgtgattggccggaactattgtgaatggtgaattcaatatcctcc |
28506783 |
T |
|
| Q |
101 |
at |
102 |
Q |
| |
|
|| |
|
|
| T |
28506782 |
at |
28506781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 75
Target Start/End: Complemental strand, 28239966 - 28239931
Alignment:
| Q |
40 |
caccaacgggtggtcttgtgattggccggaactatt |
75 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28239966 |
caccaacgggtggtcttgtgattggcctgaactatt |
28239931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 75
Target Start/End: Complemental strand, 40128 - 40093
Alignment:
| Q |
40 |
caccaacgggtggtcttgtgattggccggaactatt |
75 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40128 |
caccaacgggtggtcttgtgattggcctgaactatt |
40093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 31; Significance: 0.000000008; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 54785 - 54827
Alignment:
| Q |
40 |
caccaacgggtggtcttgtgattggccggaactattatgaatg |
82 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
54785 |
caccaatgggtggtcttgtgattggcctgaactattgtgaatg |
54827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University