View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-5 (Length: 80)
Name: Solexa-NF5704-5
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 8e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 8927711 - 8927641
Alignment:
| Q |
8 |
catcattccctggattgtagaatgaagctatggacattctagcaccatctgtttgagcaattactctgtgc |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8927711 |
catcattccctggattgtagaatgaagctatggacattctagcaccatctgtttgagcaattactctgtgc |
8927641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 10 - 71
Target Start/End: Complemental strand, 55528484 - 55528423
Alignment:
| Q |
10 |
tcattccctggattgtagaatgaagctatggacattctagcaccatctgtttgagcaattac |
71 |
Q |
| |
|
||||| |||||||| || |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
55528484 |
tcattgcctggattataaaatgaagctatggacattcttttcccatctgtttgagcaattac |
55528423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University