View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-7 (Length: 131)
Name: Solexa-NF5704-7
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 8 - 131
Target Start/End: Original strand, 44685053 - 44685176
Alignment:
| Q |
8 |
caattattgcatccaaattggcatctttttcgcccatgcactcgttgatagcaaggtccttacgtctattctcttcatcaacattttcacgtctctcttc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44685053 |
caattattgcatccaaattggcatctttttcgcccatgcactcgttgataggaaggtccttacgtctattctcttcatcaacattttcacgtctctcttc |
44685152 |
T |
|
| Q |
108 |
ttctattgacagcttggcattgtt |
131 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44685153 |
ttctattgacagcttggcattgtt |
44685176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University