View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-8 (Length: 192)
Name: Solexa-NF5704-8
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 7 - 191
Target Start/End: Complemental strand, 28269920 - 28269736
Alignment:
| Q |
7 |
atctcggccattgatttgaaatcggacgatttagattactcattcactatataaaaaatgatctgaccattggtttagattgaagggtcaagattggtaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28269920 |
atctcggccattgatttgaaatcggacgatttagattactcattcactatataaaaaatgatctgaccattggtttagattgaagggtcaagattagtaa |
28269821 |
T |
|
| Q |
107 |
ctgtgtgccataattattgtagggaatctgtttcggatgcgaagccagtttattagatgaccttaaatgtttctgttctcctatg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28269820 |
ctgtgtgccataattattgtagggaatctgtttcggatgcgaagccagtttattagatgaccttaaatgtttctgctctcctatg |
28269736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University