View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5704-9 (Length: 146)
Name: Solexa-NF5704-9
Description: NF5704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5704-9 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 7e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 2 - 146
Target Start/End: Complemental strand, 34049834 - 34049690
Alignment:
| Q |
2 |
gagagatgaaaaatcacaaaataagtgagaatgacagaaagaagggtagtgctagcaaatactcttttcaacctacttcatactattgggtaaaatcaat |
101 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34049834 |
gagagaagaaaaatcacaaaataagtgagaatgacagaaagaagggtagtgctagcaaatactcttttcaacctacttcatactattggataaaatcaat |
34049735 |
T |
|
| Q |
102 |
gtaggttcctaaccagatatgtaccaagtctgaccaaatagagag |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34049734 |
gtaggttcctaaccagatatgtaccaagtctgaccaaatagagag |
34049690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 51 - 142
Target Start/End: Original strand, 34582344 - 34582435
Alignment:
| Q |
51 |
tgctagcaaatactcttttcaacctacttcatactattgggtaaaatcaatgtaggttcctaaccagatatgtaccaagtctgaccaaatag |
142 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||| |
|
|
| T |
34582344 |
tgctagcaaatacgcttttcaacatacttcatattattgggtaaaatcaatgtaggtttctaaccaaatatgtaccaagtctgaccagatag |
34582435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University