View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-17 (Length: 178)
Name: Solexa-NF5706-17
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 8 - 168
Target Start/End: Original strand, 5243004 - 5243164
Alignment:
| Q |
8 |
ctattcatattccttatttaccacaagtttatcagtaattaattcatgattattattgctaatcataatttcaggatttgaactcaacattattgaagag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5243004 |
ctattcatattccttatttaccacaagtttatcagtaattaattcatgattattattgttaatcataatttcaggatttgaactcaacattattgaagag |
5243103 |
T |
 |
| Q |
108 |
tagaggactctcttctggagatgttgctgctcaatttaagcacaataacaaaactcttcat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5243104 |
tagaggactctcttctggagatgttgctgctcaatttaagcacaataacaaaactcttcat |
5243164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University