View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-2 (Length: 115)
Name: Solexa-NF5706-2
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 2e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 8 - 66
Target Start/End: Original strand, 225422 - 225480
Alignment:
| Q |
8 |
gtgtgagcggtttatgttgcgaaagaaaacacacttaggatatttgaaattagaaaatg |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
225422 |
gtgtgagcggtttatgttgcgaaagaaaacacacttaggatatttgaaattagaaaatg |
225480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 61 - 95
Target Start/End: Original strand, 42291517 - 42291551
Alignment:
| Q |
61 |
aaaatgtaaacattggcgagtgaccttgattgatc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42291517 |
aaaatgtaaacattggcgagtgaccttgattgatc |
42291551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University