View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-24 (Length: 137)
Name: Solexa-NF5706-24
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 1e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 33384340 - 33384433
Alignment:
| Q |
1 |
gaatactaatagaccagcaactaatgtaagtcaactagcttgggttagcctgcgggccccactttttccagtttcattttctgtttccggcgac |
94 |
Q |
| |
|
||||| |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33384340 |
gaatagtaatagactaacaactaatgtaagtcaactagcttgggttagcctgcgggccccactttttccagtttcattttctgtttccgccgac |
33384433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 98 - 137
Target Start/End: Original strand, 33384458 - 33384497
Alignment:
| Q |
98 |
tacaggtggctaccagcagcaaacttcaccggcaaaagtg |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33384458 |
tacaggtggctaccagcagcaaacttcaccggcaaaagtg |
33384497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University