View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-37 (Length: 147)
Name: Solexa-NF5706-37
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-37 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 3 - 147
Target Start/End: Complemental strand, 7499321 - 7499177
Alignment:
| Q |
3 |
gcagcacagattctttaccagccaaaaactgaggatgatttttctttgcagcagtgctgaatcccataaaaacaagtgtctgattaacaaatgacatttg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7499321 |
gcagcacagattctttaccagccaaaaactgaggatgatttttctttgcagcagtgctgaatcccataaaaacaagtggctgattaacaaatgacatttg |
7499222 |
T |
 |
| Q |
103 |
agccattggatgaaacctaggcaccacaaaaacatctcctcgctg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7499221 |
agccattggatgaaacctaggcaccacaaaaacatctccttgctg |
7499177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University