View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-4 (Length: 88)
Name: Solexa-NF5706-4
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-4 |
 |  |
|
| [»] chr4 (8 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 9e-39; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 9e-39
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 7004311 - 7004231
Alignment:
| Q |
8 |
ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgtt |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7004311 |
ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgtt |
7004231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 7027135 - 7027055
Alignment:
| Q |
8 |
ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgtt |
88 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
7027135 |
ggtagtagaagcaacaaatagagattatggttggaaacctggagatttatcaatggctggagacctttttcatttcctgtt |
7027055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 7046923 - 7046843
Alignment:
| Q |
8 |
ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgtt |
88 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7046923 |
ggtagtagaagcaacaaatagagattatgattggaaacctggagatttatcaatggttggtgaccttcttcatttcctgtt |
7046843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 13 - 88
Target Start/End: Complemental strand, 7013827 - 7013752
Alignment:
| Q |
13 |
tagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgtt |
88 |
Q |
| |
|
|||||||||| | ||| ||||||||| | ||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7013827 |
tagaagcaactgacagagattatggttcggaaccttgagatttatcaatggttggagacctttttcatttcctgtt |
7013752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 38 - 88
Target Start/End: Complemental strand, 7052925 - 7052875
Alignment:
| Q |
38 |
ttggaaacctggagatttatcaatggttggtgacctttttcatttcctgtt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
7052925 |
ttggaaacctggagatttatcaatggttggagtcctttttcatttcctgtt |
7052875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.000000000000007
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 7020240 - 7020192
Alignment:
| Q |
38 |
ttggaaacctggagatttatcaatggttggtgacctttttcatttcctg |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
7020240 |
ttggaaacctggagatttatcaatggttggagtcctttttcatttcctg |
7020192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 34 - 88
Target Start/End: Complemental strand, 6994371 - 6994317
Alignment:
| Q |
34 |
atggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgtt |
88 |
Q |
| |
|
|||||| | ||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6994371 |
atggtttggaaccttgagatttatcaatggttggagacctttttcatttcctgtt |
6994317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 88
Target Start/End: Complemental strand, 7039555 - 7039509
Alignment:
| Q |
42 |
aaacctggagatttatcaatggttggtgacctttttcatttcctgtt |
88 |
Q |
| |
|
||||||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
7039555 |
aaacctggagatttatcaatggtaggagtcctttttcatttcctgtt |
7039509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University