View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-41 (Length: 127)
Name: Solexa-NF5706-41
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 42; Significance: 0.000000000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 70 - 118
Target Start/End: Complemental strand, 44829257 - 44829208
Alignment:
| Q |
70 |
ccattgtaattttcttcatccattaaatag-ttttcaaataatcaacaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44829257 |
ccattgtaattttcttcatccattaaatagtttttcaaataatcaacaat |
44829208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 69 - 103
Target Start/End: Complemental strand, 44792292 - 44792258
Alignment:
| Q |
69 |
tccattgtaattttcttcatccattaaatagtttt |
103 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44792292 |
tccattgtaattttcctcatccattaaatagtttt |
44792258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University