View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-43 (Length: 127)
Name: Solexa-NF5706-43
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-43 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 8e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 8e-25
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 4863693 - 4863578
Alignment:
| Q |
8 |
gtattctgcttctagggttttctatactccaatatctgtgtatctccatatatatggcnnnnnnnnttaccctcaagtttnnnnnnncggcttcaaaatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
4863693 |
gtattctgcttctagggttttctatactccaatatctgtgtatctcc----atatggcaaaaaaaattaccctcaagtttaaaaaaacggcttcaaaatt |
4863598 |
T |
 |
| Q |
108 |
ttcaaccataccttatcttg |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4863597 |
ttcaaccataccttatcttg |
4863578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University