View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-45 (Length: 125)
Name: Solexa-NF5706-45
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-45 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 3e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 3e-50
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 11612665 - 11612782
Alignment:
| Q |
8 |
aagcttacaagggttatcttagaaattgcttaatgttaaagattttgttatggttggttggtatgactgtgagagtggacctgttacagttcagctggtc |
107 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612665 |
aagcttaaaagggttacattagaaattgcttaatgttaaagattttgttatggttggttggtgtgactgtgagagtggacctgttacagttcagctggtc |
11612764 |
T |
 |
| Q |
108 |
tttatcttcarcatgaag |
125 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
11612765 |
tttatcttcaacatgaag |
11612782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University