View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-47 (Length: 120)
Name: Solexa-NF5706-47
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 7 - 119
Target Start/End: Complemental strand, 4601290 - 4601178
Alignment:
| Q |
7 |
gaagcataggctgattttctgttgggtaagaatctgttttggtagatttcacataaatcctatattacatgttgaactaaagcttgtgagattttgaaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
4601290 |
gaagcataggctgattttctgttgggtaagaatctgttttggtagatttcacctaaatcctatattacatgttgaactgaagtttgtgagattttgaaca |
4601191 |
T |
 |
| Q |
107 |
gcagcgttgagtt |
119 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
4601190 |
gccgcgttgagtt |
4601178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University