View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-48 (Length: 121)
Name: Solexa-NF5706-48
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-48 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 121
Target Start/End: Complemental strand, 26323578 - 26323465
Alignment:
| Q |
8 |
tcaaactcaaatcaatctaagtatgtttagggggtatctctagattccaacagcttgtcttgaaaattcttgaaccattttcttcactctcaaatagata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26323578 |
tcaaactcaaatcaatctaagtatgtttagggggtatctctagattccaacagcttgtcttgaaaattcttgaaccgttttcttcactctcaaatagata |
26323479 |
T |
|
| Q |
108 |
ttttcaaccaacct |
121 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
26323478 |
ttatcaaccaacct |
26323465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University