View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-49 (Length: 121)
Name: Solexa-NF5706-49
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-49 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 5 - 121
Target Start/End: Original strand, 7498768 - 7498884
Alignment:
| Q |
5 |
acaactccaagaatctgaaaacatacaacatctttgatagtgaccatgacttcgaaaattgttatggttggacctcgacagtcaccaaaaagcaactaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7498768 |
acaactccaagaatctgaaaacatacaacatctttgatagtgaccatgacttcgaaaattgttatggttggacctcaacagtcaccaaaaagcaactaaa |
7498867 |
T |
 |
| Q |
105 |
acgattgaagagtaaca |
121 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7498868 |
acgattgaagagtaaca |
7498884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University