View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-52 (Length: 106)
Name: Solexa-NF5706-52
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-52 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 2e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 15050790 - 15050888
Alignment:
| Q |
8 |
gcttcttcttttccactttatcaaacaagtttcttctcaaaaacccaggttcagtttacttcacttcatttccctttccatttttacatctttttcttc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15050790 |
gcttcttcttttccactttatcaaacaagtttcttctcaaaaacccaggttcagtttacttcacttcatttccctttccatttttacatctttttcttc |
15050888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University