View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-53 (Length: 80)
Name: Solexa-NF5706-53
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 8 - 77
Target Start/End: Original strand, 37568954 - 37569024
Alignment:
| Q |
8 |
atactctcatttaattaggcttaaa-ttgaacttgcaatttctctacacatttctatcatcgtattccaca |
77 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
37568954 |
atactctcatttaattaggcttaaaattgaacttgcaatttctctacacatttgtatgatcgtattccaca |
37569024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University