View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-57 (Length: 59)
Name: Solexa-NF5706-57
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 45; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 26232087 - 26232043
Alignment:
| Q |
8 |
attcttacgtgggatatcgaaaatagttacataatttcatctctc |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26232087 |
attcttacgtgggatatcgaaaatagttacataatttcatctctc |
26232043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University