View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-60 (Length: 101)
Name: Solexa-NF5706-60
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-60 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 6e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 6e-25
Query Start/End: Original strand, 14 - 101
Target Start/End: Original strand, 27715290 - 27715370
Alignment:
| Q |
14 |
ctcttaactttcagttttagatgaagcaaatagaacactattcgaatttcgcgcctatcatgaaaaaagtgtatgaattaatcatatt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27715290 |
ctcttaactttcagttttagatgaagcaaatagaacactattcga-------gcctatcatgaaaaaagtgtatgaattaataatatt |
27715370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University