View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-63 (Length: 140)
Name: Solexa-NF5706-63
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-63 |
 | |
|
| [»] scaffold0398 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0398 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: scaffold0398
Description:
Target: scaffold0398; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 36 - 135
Target Start/End: Original strand, 15087 - 15186
Alignment:
| Q |
36 |
tgtgccctttgaggctaattctcatattcttgtcagcaacactcgcaggattctttgtcctcagaaatttccaatctcagcctaagatcgatgatgatga |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
15087 |
tgtgccctttgaggctaattctcatattcttgtcagcaacactcgcagaattctttgtcctcagaaatttccgatctcagcgtaagatcgatgatgatga |
15186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 36 - 135
Target Start/End: Complemental strand, 43041372 - 43041273
Alignment:
| Q |
36 |
tgtgccctttgaggctaattctcatattcttgtcagcaacactcgcaggattctttgtcctcagaaatttccaatctcagcctaagatcgatgatgatga |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
43041372 |
tgtgccctttgaggctaattctcatattcttgtcagcaacactcgcagtattctttgtcctcagaaattttcgatctcagcctaagatcgatgatgatga |
43041273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 8e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 8e-22
Query Start/End: Original strand, 36 - 132
Target Start/End: Complemental strand, 27288378 - 27288282
Alignment:
| Q |
36 |
tgtgccctttgaggctaattctcatattcttgtcagcaacactcgcaggattctttgtcctcagaaatttccaatctcagcctaagatcgatgatga |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||| |||| || ||| |||||||| | ||| ||||||||||||||||| |
|
|
| T |
27288378 |
tgtgccctttgaggctaattctcatattcttgtccgcaacactcgccggaatcttcgttctccgaaatttcagaaatcaacctaagatcgatgatga |
27288282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University