View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-66 (Length: 85)
Name: Solexa-NF5706-66
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-66 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 2e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 27404464 - 27404380
Alignment:
| Q |
1 |
caaaggtgaatgtttgattgctcttaagtgctaactattgctaccaaatgtcatataagctataagttttcacaaactgtgttga |
85 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27404464 |
caaaggtgaatgtttgattgctcattagtgctaactattgctaccaaatgtcatataagctataagttttcacaaactgtgttga |
27404380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University