View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5706-69 (Length: 144)
Name: Solexa-NF5706-69
Description: NF5706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5706-69 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 2e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 2e-68
Query Start/End: Original strand, 2 - 144
Target Start/End: Complemental strand, 36172856 - 36172714
Alignment:
| Q |
2 |
gactgagatgaatgctttatgaccgaagaagtctcattcattcacaaaagcatgcagggagagggaacgttagccacacataaattagttttctttttga |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36172856 |
gactgacatgaatgctttatgaccgaagaagtctcattcattcacaaaagcatgcagggagagggaaccttagccacacataaattagttttctttttga |
36172757 |
T |
|
| Q |
102 |
caggaccacacataattagctgatggattgtacagagaaaatg |
144 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36172756 |
caggaccacacataattagctgaaggattgtacagagaaaatg |
36172714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University