View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5709-12 (Length: 151)
Name: Solexa-NF5709-12
Description: NF5709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5709-12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 9e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 9e-59
Query Start/End: Original strand, 9 - 144
Target Start/End: Original strand, 48647522 - 48647659
Alignment:
| Q |
9 |
agcagagagaaaac--gagagtgatgtaataaatggaatagtttatctgatagaaagagagaaataaagagaaaatgagatttgagtagccttataaaat |
106 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48647522 |
agcaaagagaaaacaagagagtgatgtgataaatggaatagtttatgtgatagaaagagagaaataaagagaaaatgagatttgagtagccttataaaat |
48647621 |
T |
 |
| Q |
107 |
tttgaggtgtctattaatcattagaaaatgttacatag |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48647622 |
tttgaggtgtctattaatcattagaaaatgttacatag |
48647659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University