View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5709-14 (Length: 141)
Name: Solexa-NF5709-14
Description: NF5709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5709-14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 6e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 6e-63
Query Start/End: Original strand, 5 - 138
Target Start/End: Complemental strand, 45847357 - 45847224
Alignment:
| Q |
5 |
gacccttaatactatacaaactgtgactattgtctaaaatatcacttttggattatcctttaccctcgtgtcttttagcatatgcgtaagttaaaattta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45847357 |
gacccttaatactatacaaactgtgactattgtctaaaatttcacttttggattatcctttaccctcgtgtcttttagcatatgcgtaagttaaaattta |
45847258 |
T |
|
| Q |
105 |
taatcattttgttttttctttcattggagaactt |
138 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
45847257 |
taatcatttgattttttctttcattggagaactt |
45847224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University