View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5709-24 (Length: 127)
Name: Solexa-NF5709-24
Description: NF5709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5709-24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 2e-53; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 17183939 - 17183830
Alignment:
| Q |
8 |
cttaattcaagaaggataactttaattttgtcacataatgcattaactgtttttgcaatcggatggaaaaattgaagacattgtctggtatttcgcaatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17183939 |
cttaattcaagaaggataactttaattttgtcacataatgcattaactgtttttgcaatcgggtggaaaaattgaagacattgtctggtatttcgcaatt |
17183840 |
T |
|
| Q |
108 |
atacagcagg |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
17183839 |
atacagcagg |
17183830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 17196465 - 17196574
Alignment:
| Q |
8 |
cttaattcaagaaggataactttaattttgtcacataatgcattaactgtttttgcaatcggatggaaaaattgaagacattgtctggtatttcgcaatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17196465 |
cttaattcaagaaggataactttaattttgtcacataatgcattaactgtttttgcaatcggatggaaaaatttaagacattgtctggtatttcgcaatt |
17196564 |
T |
|
| Q |
108 |
atacagcagg |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
17196565 |
atacagcagg |
17196574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 83; E-Value: 9e-40
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 17193645 - 17193739
Alignment:
| Q |
8 |
cttaattcaagaaggataactttaattttgtcacataatgcattaactgtttttgcaatcggatggaaaaattgaagacattgtctggtatttcg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
17193645 |
cttaattcaagaaggataactttaattttgtcacataatgcattaattgtttttgcaatcagatggaaaaattgaagacattgtctggtgtttcg |
17193739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University