View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5709-4 (Length: 123)
Name: Solexa-NF5709-4
Description: NF5709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5709-4 |
 | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0082 (Bit Score: 112; Significance: 4e-57; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 112; E-Value: 4e-57
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 32814 - 32929
Alignment:
| Q |
1 |
atgagttctgtggcaagctgacggattctgcaacttcttatcttccgaaataagtttttattctaagagcggatatttcaaagagagcgccggatcttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32814 |
atgagttctgtggcaagctgacggattctgcaacttcttatcttccgaaataagtttttattctaagagcggatatttcaaagagagcaccggatcttgc |
32913 |
T |
|
| Q |
101 |
atgaatgtgcacatcc |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32914 |
atgaatgtgcacatcc |
32929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University