View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5709-40 (Length: 110)
Name: Solexa-NF5709-40
Description: NF5709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5709-40 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 5 - 110
Target Start/End: Original strand, 48185855 - 48185960
Alignment:
| Q |
5 |
gattctgaggaagctactctttgcaatgaccaacaaaaatgcacaggtagcttgaagaaaacagcttctaaagcatccagaaaatcccacaaccacttac |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||| |
|
|
| T |
48185855 |
gattctgaggaagctactctttgcaatgaccaacaaaaatgcacaggtagcttgaagaaaacagcttctaaagtatccagaaaatcacacaaccagttac |
48185954 |
T |
|
| Q |
105 |
cacaga |
110 |
Q |
| |
|
|||||| |
|
|
| T |
48185955 |
cacaga |
48185960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University