View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5709-42 (Length: 139)
Name: Solexa-NF5709-42
Description: NF5709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5709-42 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 2e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 55 - 139
Target Start/End: Original strand, 45756907 - 45756991
Alignment:
| Q |
55 |
aatattcttttcgatggtacttttgtcaataatgtttggttcttctcacatgaagatttcaccttattagatattcgcattttgc |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45756907 |
aatattcttttcgatggtacttttgtcaataatgtttggttcttctcacattaagatttcaccttattagatattcgcattttgc |
45756991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 9e-25
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 45756812 - 45756869
Alignment:
| Q |
2 |
caaaggacaaaatggtactaacaaacttaaattttgggaaaacatttgctatgaatat |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45756812 |
caaaggacaaaatggtactaacaaacttaaattttgggaaaacatttgctatgaatat |
45756869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University