View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5709-44 (Length: 141)
Name: Solexa-NF5709-44
Description: NF5709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5709-44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 5 - 120
Target Start/End: Complemental strand, 26462260 - 26462145
Alignment:
| Q |
5 |
gaatacattgtaagggagaacaacatcatgcggtggtatcatcagagaggcagcagtgatgatgagtggattgacaacgtctctaaaactttagatgcgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
26462260 |
gaatacattgtaagggagaacaacatcatgcggtggtatcatcagagaggcagcagtgatgatgagtggattgacaacgtctctaaaattttagatgggt |
26462161 |
T |
|
| Q |
105 |
ttagttttattattat |
120 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26462160 |
acagttttattattat |
26462145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University