View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5709-7 (Length: 221)
Name: Solexa-NF5709-7
Description: NF5709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5709-7 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 48 - 221
Target Start/End: Original strand, 6197635 - 6197808
Alignment:
| Q |
48 |
taataataagggaaaaattgccagagctgagaaccactcttcaatcctaatccattctcaatgatttctgtattctatttttctcaacttccacttttct |
147 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6197635 |
taataataaggggaaaattgctagagctgagaaccactcttcaatcctaatccattctcaatgatttctgtattctatttttctcaacttccacttttct |
6197734 |
T |
 |
| Q |
148 |
gttcatttttattcaaaatatgaattcccatcatattcattagttactgggttaaccaatttgagttttgtctg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6197735 |
gttcatttttattcaaaatatgaattcccatcattttcattagttactgggttaaccaatttgagttttgtctg |
6197808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 46
Target Start/End: Original strand, 6197098 - 6197136
Alignment:
| Q |
8 |
gagacaagtgacgttaccaagtacgaggcaataatatta |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6197098 |
gagacaagtgacgttaccaagtacgaggcaataatatta |
6197136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University