View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5795-5 (Length: 133)
Name: Solexa-NF5795-5
Description: NF5795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5795-5 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 3e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 9 - 133
Target Start/End: Complemental strand, 47528237 - 47528113
Alignment:
| Q |
9 |
agcaaagggaaaacatgtagatagaaaatacctacagcattcaaccagaagttaggaatagattggatcatctcatcccgcttaatgtaaacgggagcta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47528237 |
agcaaagggaaaacatgtagatagaaaatactcacagcattcaaccagaagttaggaatagatttgatcatctcatcccgcttaatgtaaacgggatcta |
47528138 |
T |
|
| Q |
109 |
tagtctcatttaacttctgctcaat |
133 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47528137 |
tagtctcatttaacttctgctcaat |
47528113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 33 - 92
Target Start/End: Original strand, 44983877 - 44983936
Alignment:
| Q |
33 |
aaaatacctacagcattcaaccagaagttaggaatagattggatcatctcatcccgctta |
92 |
Q |
| |
|
||||||| ||||||||||||||||| | ||||||||||| ||| ||||| | ||||||| |
|
|
| T |
44983877 |
aaaatactcacagcattcaaccagaaatcaggaatagatttgataatctcgttccgctta |
44983936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University