View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5795-6 (Length: 115)
Name: Solexa-NF5795-6
Description: NF5795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5795-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 9e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 9e-49
Query Start/End: Original strand, 10 - 115
Target Start/End: Complemental strand, 915169 - 915064
Alignment:
| Q |
10 |
attaaggctgcgcctattttgattatggatgagaaacgcgcactacacactcatcagtcatcatctaaggcaactcttgactctcaccaaggtttagacc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
915169 |
attaaggctgcgcctattttgattatggatgagaaacgcgcactacacactcaccagtcatcatctaagacaactcttgactctcaccaaggtttagacc |
915070 |
T |
|
| Q |
110 |
tatgct |
115 |
Q |
| |
|
|||||| |
|
|
| T |
915069 |
tatgct |
915064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University