View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5795-7 (Length: 114)
Name: Solexa-NF5795-7
Description: NF5795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5795-7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 10 - 114
Target Start/End: Complemental strand, 39394322 - 39394218
Alignment:
| Q |
10 |
ttcttcttccattttactcatctgctccttagtttgactcaacttgctatcgtattgctccatacgatgctgctgttgcatcatttgaacgttgagaatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39394322 |
ttcttcttccattttactcatctgctccttagtttgactcaacttgctatcatattgctccatacgatgctgctgttgcatcatttgaacgttgagaatt |
39394223 |
T |
 |
| Q |
110 |
tatat |
114 |
Q |
| |
|
||||| |
|
|
| T |
39394222 |
tatat |
39394218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University