View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5795-8 (Length: 96)
Name: Solexa-NF5795-8
Description: NF5795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5795-8 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 8e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 8e-21
Query Start/End: Original strand, 46 - 96
Target Start/End: Original strand, 3239144 - 3239194
Alignment:
| Q |
46 |
attgaaatgaggaagatggttattccttcaaatccagaagccattgatttt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3239144 |
attgaaatgaggaagatggttattccttcaaatccagaagccattgatttt |
3239194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.000000000008
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 23472468 - 23472511
Alignment:
| Q |
8 |
tcaatgtgtcggtgtgtccgtataagtgcctcatagctattgaa |
51 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
23472468 |
tcaatgtgtcggcgtgtccgtacaagtgcctcatagctattgaa |
23472511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University