View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5797-10 (Length: 144)
Name: Solexa-NF5797-10
Description: NF5797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5797-10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 144
Target Start/End: Complemental strand, 6627238 - 6627096
Alignment:
| Q |
8 |
gattgtcggttgccgtcgccattgccgaaagaagcttctgggccatccccgtcgccgagagaagcttctggtagagtcacggaatctga------tgttg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6627238 |
gattgtcggttgccgtcgccattgccgaaagaagcttctggaccatccctgtcgccgagagaagcttctggtagagtcacggaatctgatgttaatgttg |
6627139 |
T |
|
| Q |
102 |
gtgttggttctcttcccgttggatttaaaatgcgcaggtaatt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6627138 |
gtgttggttctcttcccgttggatttaaaatgcgcaggtaatt |
6627096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University