View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5797-11 (Length: 142)
Name: Solexa-NF5797-11
Description: NF5797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5797-11 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 2 - 142
Target Start/End: Complemental strand, 41090298 - 41090158
Alignment:
| Q |
2 |
agagtttggcagccgaggatcgaaatcccaaatgaatgttgctggtattcataaacaaaaacatgtgtagtctatagatctgccaattcaatgcagctag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41090298 |
agagtttggcagccgaggatcgaaatcccaaatgaatgttgctgctattcataaacaaaaacatgtgtagtctatagatctgcgaattcaatgcagctag |
41090199 |
T |
|
| Q |
102 |
gaagaagtcagcaaaacaatgaatatatatgccaaaaatgg |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41090198 |
gaagaagtcagcaaaacaatgaatatatatgccaaaaatgg |
41090158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University