View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5797-14 (Length: 137)
Name: Solexa-NF5797-14
Description: NF5797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5797-14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 6626384 - 6626516
Alignment:
| Q |
1 |
ggggtttattcctccaggactttgatggggagaagaggcgccatcaatgcctgatgcagataaatcaaagaaagcaggaggtggttgccccgtagatgtt |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626384 |
ggggttttttcctccaggactttgatggggagaagaggcaccatcaatgcctgacgcagataaatcaaagaaagcaggaggtggttgccccgtagatgtt |
6626483 |
T |
|
| Q |
101 |
ggcatttctggtgcagaccagaattgatttgct |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6626484 |
ggcatttctggtgcagaccagaattgatttgct |
6626516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University