View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5797-16 (Length: 130)
Name: Solexa-NF5797-16
Description: NF5797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5797-16 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 3e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 43054109 - 43054233
Alignment:
| Q |
8 |
actcttaagtttta--atttatgtggtacaataatgtggatatttcaccttcagacctctatgaatatttatctttgacaagcaagggtgtttttatgat |
105 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43054109 |
actcttaagttttataatttatgtggtacaataatgtggatatttcaccttcagacctctatgaatatttatctttgacaagcaagggtgtttttatgat |
43054208 |
T |
|
| Q |
106 |
actttttgttctttcttttcaatag |
130 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43054209 |
actttttgttctttcttttcaatag |
43054233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 15 - 109
Target Start/End: Original strand, 43037987 - 43038081
Alignment:
| Q |
15 |
agttttaatttatgtggtacaataatgtggatatttcaccttcagacctctatgaatatttatctttgacaagcaagggtgtttttatgatactt |
109 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43037987 |
agttttaatctatgtggtacaataatgtggatatttcactttcagacctctatgcatatttatctttgacaagcaagggtgtttttatgatactt |
43038081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University