View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5797-18 (Length: 127)
Name: Solexa-NF5797-18
Description: NF5797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5797-18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 6185778 - 6185897
Alignment:
| Q |
8 |
cagagccttggtgagatttcagacaaatcactgcttaaaaaagatggttcaagtacatgtaaagattttgttgttttggttcaaaattggctgaacaaaa |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6185778 |
cagagccttggtgacatttcagacaaatcactgcttaaaaaagatggttcaagtacatgtaaagattttgttgttttggttcaaaattggctgaacaaaa |
6185877 |
T |
|
| Q |
108 |
ttaaggtagcatccataatg |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6185878 |
ttaaggtagcatccataatg |
6185897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 7e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 39030480 - 39030374
Alignment:
| Q |
8 |
cagagccttggtgagatttcagacaaatcactgcttaaaaaagatggttcaagtacatgtaaagattttgttgttttggttcaaaattggctgaacaaaa |
107 |
Q |
| |
|
|||||||||| ||||||| | |||| ||||| | || |||||||||||||||||||||| ||||||||||| | ||||||||| ||||||| ||||| |
|
|
| T |
39030480 |
cagagccttgatgagattactgacaggtcacttcgtagaaaagatggttcaagtacatgtgaagattttgttagtctggttcaaacatggctgagcaaaa |
39030381 |
T |
|
| Q |
108 |
ttaaggt |
114 |
Q |
| |
|
|| |||| |
|
|
| T |
39030380 |
ttcaggt |
39030374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University