View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5797-9 (Length: 150)
Name: Solexa-NF5797-9
Description: NF5797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5797-9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 9e-62; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 9e-62
Query Start/End: Original strand, 12 - 139
Target Start/End: Complemental strand, 43054690 - 43054563
Alignment:
| Q |
12 |
tgaacgaatgtgaagatgagagtgaagttatcttatgacaagctatttacatgcatatgcctttatagtagcaacttgcccggaataaaatattaaagat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43054690 |
tgaacgaatgtgaagatgagagtgaagttatcttatgacaagctatatacatgcatatgcctttatagtagcaacttgcccggaataaaacattaaagat |
43054591 |
T |
|
| Q |
112 |
ttatggtagggaatgcatgggactgtct |
139 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43054590 |
ttatggtagggaatgcatgggactgtct |
43054563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 9e-22
Query Start/End: Original strand, 12 - 80
Target Start/End: Original strand, 43030290 - 43030358
Alignment:
| Q |
12 |
tgaacgaatgtgaagatgagagtgaagttatcttatgacaagctatttacatgcatatgcctttatagt |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
43030290 |
tgaacgaatgtgaagatgagagtgaagttatcttatgacacgctatttaggtgcatatgtctttatagt |
43030358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 99 - 134
Target Start/End: Original strand, 43031079 - 43031114
Alignment:
| Q |
99 |
aaatattaaagatttatggtagggaatgcatgggac |
134 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43031079 |
aaatattaaagatttatggtatggaatgcatgggac |
43031114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 145
Target Start/End: Original strand, 43031013 - 43031060
Alignment:
| Q |
95 |
aataaaatattaaagatttatggtagggaatgcatgggactgtctttgata |
145 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| |||||||||| |
|
|
| T |
43031013 |
aataaaatattaaagattta---tatggaatgcatgggacagtctttgata |
43031060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University