View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5798-21 (Length: 107)
Name: Solexa-NF5798-21
Description: NF5798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5798-21 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 9e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 9e-52
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 16707102 - 16707208
Alignment:
| Q |
1 |
cagacataactttagagctctctccgtatgagaaaagtcattcatgactctttttgcctaacacgtagatctattcaaacatgaagagagcataaaatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16707102 |
cagacataactttagagctctctccgtatgagaaaagtcattcatgactctttttgcctaacacgtagatctattcaaacatgaagagagcataacatca |
16707201 |
T |
|
| Q |
101 |
catacag |
107 |
Q |
| |
|
||||||| |
|
|
| T |
16707202 |
catacag |
16707208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University